UEFA Champions League
£4.99

Promotions apply when you purchase

These promotions will be applied to this item:

Some promotions may be combined; others are not eligible to be combined with other offers. For details, please see the Terms & Conditions associated with these promotions.

Sold by Amazon Media EU S.à r.l.. This price was set by the publisher.
You've subscribed to ! We will pre-order your items within 24 hours of when they become available. When new books are released, we'll charge your default payment method for the lowest price available during the pre-order period.
Update your device or payment method, cancel individual pre-orders or your subscription at
Your Memberships and Subscriptions
Kindle app logo image

Download the free Kindle app and start reading Kindle books instantly on your smartphone, tablet or computer – no Kindle device required.

Read instantly on your browser with Kindle for Web.

Using your mobile phone camera - scan the code below and download the Kindle app.

QR code to download the Kindle App

Follow the author

Adam Rutherford PhD
Follow
Something went wrong. Please try your request again later.

Creation: The Origin of Life / The Future of Life Kindle Edition

by Adam Rutherford (Author) Format: Kindle Edition
4.2 4.2 out of 5 stars 237 ratings
See all formats and editions

'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer

Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives.

'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday

The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer.

'A superbly written explanation' Brian Cox

The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind.

'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph

'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer

'The perfect primer on the past and future of DNA' Guardian

'Susenseful, erudite and thrilling' Prospect

'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain

'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili

'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times

'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk

'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts

'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome

'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times

Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book.

TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG

Previous slide of product details
  1. Print length
    345 pages
  2. Language
    English
  3. Publisher
    Penguin
  4. Publication date
    4 April 2013
  5. File size
    1.6 MB
  6. Page Flip
    Enabled
  7. Word Wise
    Enabled
  8. Enhanced typesetting
    Enabled
Next slide of product details

Product description

Review

I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English (Financial Times)

One of the most eloquent and genuinely thoughtful books on science over the past decade ... You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology ... Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet (Nick Lane Observer)

A fascinating glimpse into our past and future ... [Rutherford] argues persuasively against those who seek to hold back scientific progress. His illuminating book is full of optimism about what we might be able to achieve (Sunday Times)

Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller. Fascinating (Mail on Sunday)

This is a quite delightful two books in one. It is becoming increasingly clear that the 21st is the century of biology. This book is the perfect "story so far" (Jim Al-Khalili, author of Paradox)

Fascinating ... The extraordinary science and his argument are worth every reader's scrutiny (Sunday Telegraph)

A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know (Dara O Briain)

Suspenseful, erudite and thrilling (Prospect)

The perfect primer on the past and future of DNA ... Rutherford tells his stories with great brio and a disarming line in personal commentary (Guardian)

A superbly written explanation of how the origin of life on Earth became a question for science, and what the answer might be (Brian Cox)

An engaging account of both the mystery of life's origin and its impending resolution, as well as a fascinating glimpse of the impending birth of a new, synthetic biology (Matt Ridley, author of Genome)

In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers (Alice Roberts)

About the Author

Dr Adam Rutherford is a geneticist, writer and broadcaster, whose work includes the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous programmes for BBC Radio 4. He is an editor at the science journal Nature, writes for the Guardian and has given numerous prestigious lectures, as well as appearing in the 'Uncaged Monkeys' tour.

Product details

  • ASIN ‏ : ‎ B00BLVO8VE
  • Publisher ‏ : ‎ Penguin (4 April 2013)
  • Language ‏ : ‎ English
  • File size ‏ : ‎ 1.6 MB
  • Text-to-Speech ‏ : ‎ Enabled
  • Screen Reader ‏ : ‎ Supported
  • Enhanced typesetting ‏ : ‎ Enabled
  • X-Ray ‏ : ‎ Not Enabled
  • Word Wise ‏ : ‎ Enabled
  • Print length ‏ : ‎ 345 pages
  • Customer reviews:
    4.2 4.2 out of 5 stars 237 ratings

About the author

Follow authors to get new release updates, plus improved recommendations.
Adam Rutherford PhD

Adam Rutherford PhD

Brief content visible, double tap to read full content.
Full content visible, double tap to read brief content.

Hello, I'm Dr Adam Rutherford, a science writer and broadcaster. I studied genetics at University College London, and during my PhD on the developing eye at the Institute of Child Health at Great Ormond St Hospital, I was part of a team that identified the first genetic cause of a form of childhood blindness. Since then, I worked as an editor at the journal Nature, and have written several books; my first book, CREATION, on the origin of life and synthetic biology, was shortlisted for the Wellcome Trust Prize.

On radio, I present BBC Radio 4’s weekly programme Inside Science, and with Dr. Hannah Fry, the Curious Cases of Rutherford and Fry. I've also written and presented documentaries on subjects ranging from the history of sex, the evolution of morality, to the MMR-Autism scandal.

I've written and presented several award winning television documentaries, including The Cell (2009), The Gene Code (2011), the Beauty of Anatomy (2014), and Playing God, on the rise of synthetic biology for the BBC’s long-running science series Horizon. I’ve also appeared on programmes including James Cameron’s The Story of Science Fiction (2018), University Challenge (2016).

I’ve worked on a number of films as a scientific consultant too, including Annihilation (dir. Alex Garland, 2018), Ex Machina (dir. Alex Garland, 2015), Life (dir. Daniel Espinosa, 2016)

Bjork: Biophilia Live (dir. Peter Strickland, 2014), Kingsmen: The Secret Service (dir. Matthew Vaughan, 2014).

adamrutherford.com | @AdamRutherford

Customer reviews

4.2 out of 5 stars
237 global ratings

Review this product

Share your thoughts with other customers
Write a customer review

Customers say

Customers find the book's writing style engaging and informative. They find the subject fascinating and thought-provoking, rekindling their interest in the subject. The book is described as entertaining and enjoyable. Readers appreciate the author's knowledge of evolutionary genetics and synthetic biology.

AI-generated from the text of customer reviews

Select to learn more

Writing styleInterestEntertainment valueOrigins
17 customers mention ‘Writing style’14 positive3 negative

Customers find the book's writing style engaging and easy to understand. They appreciate the author's clear presentation of complex concepts in an accessible manner. The grammar is described as beautiful, and the descriptions are helpful. Overall, readers describe it as a fantastic read that presents the subject matter clearly.

"...Rutherford has a very engaging writing style, and his enthusiasm for the subject matter is infectious - you can't help but feel exciting as you tour..." Read more

"A concise and readable review of the concepts underlying the possible start of life followed by an interesting account of the development of life" Read more

"...Clearly written, with complex subjects presented in a very accessible way...." Read more

"...'science' to keep it interesting but not too much, which makes it easier to read and the author's writing style keeps the book very entertaining as..." Read more

15 customers mention ‘Interest’15 positive0 negative

Customers find the book fascinating and thought-provoking. It rekindles their interest in the subject, providing an overview of current theories. They find it informative and illuminating, with complex subjects presented in an accessible way. The book is described as an amazing read and a real eye-opener to what is possible in the future.

"...has a very engaging writing style, and his enthusiasm for the subject matter is infectious - you can't help but feel exciting as you tour through..." Read more

"...the possible start of life followed by an interesting account of the development of life" Read more

"...Clearly written, with complex subjects presented in a very accessible way...." Read more

"...He lauds `Darwin's idea' as `self evidently true, demonstrably true, experimentally true' (footnote page25 Book 1 plus more in this vein on page 26)...." Read more

4 customers mention ‘Entertainment value’4 positive0 negative

Customers enjoy the book's writing style. They find it entertaining and informative.

"...it easier to read and the author's writing style keeps the book very entertaining as well as informative...." Read more

"...fundamental story and is very informative, not to mention is surprisingly engaging. It is a thrifty two books in one...." Read more

"...on his subject and has the ability to present it in a clear and entertaining manner." Read more

"Concise and fun review of the creation of Life..." Read more

4 customers mention ‘Origins’4 positive0 negative

Customers appreciate the book's origins. They say it explains the origins of life and provides a reasonable breadth of knowledge about evolutionary genetics and synthetic biology.

"Adam Rutherford's account of the origin of life is interesting but confusing...." Read more

"...career of actually doing science, Adam has a reasonable breadth of knowledge of evolutionary genetics and synthetic biology, and quite of a lot of..." Read more

"...HIGHLY recommend to anyone interested to discover more about DNA, origins of life, and the potential for synthetic biology." Read more

"Creation , the origin of life is fantastic, really gripping and I'm about to reread it straight away!..." Read more

Top reviews from United Kingdom

  • Professor Peter Etchells
    5.0 out of 5 stars An absolute must-read
    Reviewed in the United Kingdom on 13 April 2013
    Verified Purchase
    I used to love Biology at school, even though very often the way it was taught was stuffy, with the science coming across as stagnant. Creation completely smashes that myth into pieces, presenting the history of how we discovered the inner workings of life, and how we're starting to build on this knowledge to create new, synthetic life. Rutherford has a very engaging writing style, and his enthusiasm for the subject matter is infectious - you can't help but feel exciting as you tour through things like the discovery of DNA, and some of the controversy surrounding GM. He presents what are, at times, quite difficult concepts in an easy-to-understand, friendly manner that makes you want to learn more. It would be the perfect, complimentary companion to students taking GCSEs or A-Levels in Biology, and for older readers, does a spectacularly good job of rekindling interest in the subject. In short: get this book, you won't be disappointed.
    18 people found this helpful
    Helpful
     Report
  • Mark Smith
    4.0 out of 5 stars Concise and fun review of the creation of Life
    Reviewed in the United Kingdom on 22 November 2013
    Verified Purchase
    A concise and readable review of the concepts underlying the possible start of life followed by an interesting account of the development of life
    One person found this helpful
    Helpful
     Report
  • Susanne
    5.0 out of 5 stars Brillant and informative read
    Reviewed in the United Kingdom on 18 July 2021
    Verified Purchase
    Have read a few books on the origin of life - this is by far the best. Clearly written, with complex subjects presented in a very accessible way. I got further in my understanding of many aspects of biology and chemistry - and the link between the two - than ever before. I really loved the book.
    2 people found this helpful
    Helpful
     Report
  • Geoff Crocker
    3.0 out of 5 stars Interesting but Confusing
    Reviewed in the United Kingdom on 14 May 2013
    Verified Purchase
    Adam Rutherford's account of the origin of life is interesting but confusing. He very frequently presents confusing statements of the certainty of scientific knowledge. For example on page 56 he writes ` we know that..the planet was probably largely molten..contrary to previous thinking we now think' and then tells us on the next page that the source of the earth's water `remains controversial'. Similarly on page 97 on the language code of life, he uses phrases like `rather plausible', `we now have a grasp', `we have credible roots', interchangeably. This terminology is too loose - we can `know that ..probably' anything. As genetics researcher Nick Lane in his review of the book (Observer 6 April 2013) says `we know less than we think'.

    In chapter 4 Rutherford shows that a unique definition of life is difficult to state - `the boundary between chemistry and biology is arbitrary' (page 72). How then can we explain what we can't define? In chapter 6, any theory of the genesis of the code of life appears to be highly speculative.

    Rutherford sets out lots of data, but his overall interpretation is weak. He covers too much ground, from Darwin to cell theory, to meteor bombardment, to RNA and DNA, ribosome and ribozyme codes, some of the latter in such detail that it makes the points difficult to follow, and an overall synthesis difficult to assimilate.

    He lauds `Darwin's idea' as `self evidently true, demonstrably true, experimentally true' (footnote page25 Book 1 plus more in this vein on page 26). But this typical position closes off intellectual development of Darwin. Darwin insisted that mutations are random, but selection logical. It is entirely possible that the reverse could hold, ie that mutations are adaptive, as more recent neo-Lamarckian research suggests, and selection a random process of predation, chance, catastrophe etc. Similarly, saltation may be a better explanator than mutation. And as Rutherford admits on page 14 of Book 2, the species barrier is `one of the great questions in biology'. It is the crossing of this barrier that Darwin addresses, and his continuous incremental theory does have a problem in explaining a discrete process of speciation. If as Rutherford points out, the definition of a species is reproductive isolation, ie organisms that can reproduce to yield fertile offspring, then crossing such a discrete barrier by a slow incremental process is problematic. How does the first organism in a new species find a mate capable of fertile reproduction?

    Rutherford does treat the genetic work of Gregor Mendel, but doesn't make the explicit connection that Mendel's work on dominant genes rescued Darwin's theory from blending of new mutations back into the host population. He doesn't mention W D Hamilton's theory of the `selfish gene' as a response to altruism as a challenge to Darwin at all. By page 45, Rutherford is telling us that the evolutionary story is `almost always only ever hypothetical' and claims of species descent are `often overstating what we can know'.

    The second half of the book is an outline of synthetic biology and a defence of GM crop research and is less cataclysmic than the build up leads us to expect. It doesn't really match up to its claim as an account of `the future of life'.

    The book exemplifies a problem with popular science writing by media scientists who know the people who are doing science but aren't doing it themselves. They are writing for an audience who are unqualified to answer back, who are being told rather than being engaged in debate. Rutherford does this with panache, with almost schoolboy enthusiasm in what sometimes reads like a brain dump. But the didactic unilateralism of the exercise is somehow unsatisfactory. Isn't there something for us to think about, rather than being told?
    20 people found this helpful
    Helpful
     Report
  • Paul Lonsdale
    5.0 out of 5 stars Brilliant
    Reviewed in the United Kingdom on 3 March 2014
    Verified Purchase
    Really enjoyed this book. Eye opening and very thought provoking; especially part 2: the future of life. As a nutritionist, I try and read a lot about physiology, cell biology and genetics but I've learnt more from this book than anything else I've read in years. Just enough 'science' to keep it interesting but not too much, which makes it easier to read and the author's writing style keeps the book very entertaining as well as informative. I'll certainly look out for more of his work.
    2 people found this helpful
    Helpful
     Report
  • Mr. D. Mccabe
    4.0 out of 5 stars Interesting history and future speculation.
    Reviewed in the United Kingdom on 30 October 2013
    Verified Purchase
    Why make a POINT of insisting that the word "bacilli" should no longer follow the Latin rule of "-us" singular and "-i" plural and then use it for both? If it's not Latin, then why does it not follow English rules and add "s" for the plural? End of rant!
    2 people found this helpful
    Helpful
     Report
  • JWooney
    2.0 out of 5 stars A gimmick too far
    Reviewed in the United Kingdom on 7 April 2014
    Verified Purchase
    There were a number of things that I didn't like about the book. Firstly, the book is split into two halves, the origin of life, and the future of life. I am a biology undergraduate, so the origin of life was just a repeat of things that I have already learnt, told in a more confusing way. If I did not study biology I'm sure I would have found it more interesting, but I still would have not enjoyed it massively. However, the future of life was fairly interesting, even if it did jump from point to point frivolously.

    Secondly, I personally didn't like the writing style. The number of analogies was too high and the quality of them was too low. There were far too many footnotes, which just ruin the flow of the book and interrupt any sort of rhythm that you manage to generate while wading through the average descriptions. Also, the writing itself was just grating, half chatty, half formal, and a strange use of 'jargon' where it was removed in some cases (both correctly and incorrectly) and inexplicably left in the text in other cases.

    All in all, I would have enjoyed it more if I didn't have a background in the topic, but whether it would have moved my rating up to a 3 is unlikely, as the writing itself was one of the major problems.
    5 people found this helpful
    Helpful
     Report
  • Hasnath
    5.0 out of 5 stars Excellent
    Reviewed in the United Kingdom on 25 April 2013
    Verified Purchase
    Adam Rutherford is an up and coming science icon. The way in which he's managed to write this book is impressive. It is enticing yet tells a very fundamental story and is very informative, not to mention is surprisingly engaging. It is a thrifty two books in one. I also got my copy signed by him, so I'm chuffed.
    I would recommend the hardback version of the book as it'll last longer and look good on your shelf.
    3 people found this helpful
    Helpful
     Report

Top reviews from other countries

  • GM Bris.
    5.0 out of 5 stars Great Book
    Reviewed in Australia on 18 June 2023
    Verified Purchase
    Great Book
    Report
  • S. M. S.
    4.0 out of 5 stars good read but left me tethering at the edge of ...
    Reviewed in India on 12 November 2015
    Verified Purchase
    good read but left me tethering at the edge of a precipice. all in all a grand view of our current understanding of LIFE.
    Report
  • A. D. Thibeault
    4.0 out of 5 stars A Brief Summary and Review
    Reviewed in Canada on 3 July 2013
    Verified Purchase
    *A full executive summary of this book is available at newbooksinbrief dot com.

    As the blueprint of all that lives, deoxyribonucleic acid (DNA) may be said to be the key to understanding life itself. It is incredible to think, then, that the structure of DNA was only discovered some 60 years ago (thanks especially to the work of James Watson and Francis Crick). Since that time, many significant advances in genetics have been made—including the deciphering of the genomes of numerous species (including our own); and, even more impressively, the successful manipulation of the genetic code to introduce the features of one species to another (for example, having a goat produce spider’s silk out of its milk).

    As impressive as these feats are, though, they are but the beginning of what promises to come from the study of genetics. Indeed, compared with other sciences, such as physics and chemistry, genetics is still in its infancy, and we can be assured that the most significant discoveries and applications are yet to come. Even now, geneticists are making significant progress in uncovering the origin of life—meaning answering the question of just how life may have sprung out of lifeless chemistry—and are also making advancements in turning genetic manipulation into a standardized engineering science that is capable of churning out technological solutions in everything from food production to energy to medicine (a field that has been dubbed ‘synthetic biology’). It is these recent advances in genetics that are the main topic of Creation: How Science is Reinventing Life Itself by science writer Adam Rutherford.

    Rutherford begins by giving us a refresher in basic biology, by way of running through the 3 ideas that stand at the heart of biology: 1) cell theory; 2) Darwin’s theory of evolution by natural selection; and 3) the structure and operation of DNA. Each of these ideas leads us to the conclusion that life began at a single point, but does not address the question of how life began in the first place. Now, though, this question is being addressed, and Rutherford updates us on the progress.

    A living organism requires both a structure that can be replicated, and some energy to carry out this replication; thus the question of the origin of life comes down to the question of how this structure originally came to be organized, and where the energy came from to allow for the replication. With regards to the first part of this question, scientists have been able to trace out the likely original constituents of the first organism, and have also established that many of these original constituents readily self-organize into the form that they take when the right molecules and conditions are present—thus while the question of the original structure of life has not yet been solved entirely, geneticists are hot on the trail of doing just this.

    Second, with regards to the energy problem, it has been established that, originally, the energy needed for replication could well have come from outside of the biological structure itself—the most likely candidate at this point being the energy from hydrothermal vents at the bottom of the ocean. Experiments are currently underway that recreate the physical and chemical conditions at the bottom of the ocean near hydrothermal vents—but the hit and miss nature of this procedure means that there are no guarantees these experiments will be successful in procuring life.

    When it comes to creating life from scratch, the better bet might be that this will come from synthesizing the basic biological parts and manipulating them into the organization that is needed for them to carry on into perpetuity. This is the domain of a new science called synthetic biology. Of this domain we learn that geneticists have already been able to synthesize many biological structures—and have even synthesized DNA and introduced it into a cell where it functions normally, like any other DNA.

    While creating life form scratch is one goal of synthetic biology, it is subordinate to a much larger goal, which is to take full control of genetic information in order that it may be used for any number of purposes, from incapacitating viruses, to creating synthetic biofuel, to fabricating food stuffs that carry any biological feature we may want. Scientists have in fact already made considerable progress in these areas. However, they have also run into some significant barriers along the way—largely having to do with the sheer complexity of biological systems. Still there is hope that this complexity will ultimately be tamed.

    One part of this taming effort comes from the endeavor to create standardized genetic components that are capable of carrying out a specific function. The spirit of this enterprise is captured in the iGEM competition—an international competition that brings together teams of university students from every corner of the planet with one goal: to demonstrate a unique biological function using standard genetic parts, called ‘BioBricks’ (drawn from a library of these BioBricks that the students are themselves encouraged to add to in the course of their projects). The iGEM competition has already churned out some very impressive applications, and the speed of progress is very encouraging.

    Rutherford does a very good job of covering some of the most significant recent advances in genetics, and of explaining the science behind it. The author also does well to capture the promise of the recent advances, while at the same time acknowledging the significant obstacles that stand in the way of future progress. The offering is certainly more readable than George Church's latest book Regenesis: How Synthetic Biology Will Reinvent Nature and Ourselves--to which this book will no doubt be compared. However, Rutherford (despite having a solid background in biology himself) does not have quite the insider's perspective that someone like Church does, which is the only drawback I see here. All in all a very good popular science book on a very important topic. A full executive summary of the book is available at newbooksinbrief dot com; a podcast discussion of the book will be available soon.
    Report
  • Book Shark
    5.0 out of 5 stars Entertaining and Enlightening Science!
    Reviewed in the United States on 21 June 2013
    Verified Purchase
    Creation: How Science is Reinventing Life Itself by Adam Rutherford

    "Creation: How Science is Reinventing Life Itself" is a fascinating journey from the origins of all life and the origins of new artificial life. Science writer, Adam Rutherford takes the reader through the golden age of biology and explores the pathways to life on Earth and how to re-create it. What sets this book apart is the author's innate ability to make complex topics accessible, enlightening and entertaining. This excellent 288 page-book is composed of two halves: the first half covers the origin of life, while the second half covers how scientists are designing, engineering and building new life-forms for a purpose.

    Positives:
    1. A well-written, engaging, entertaining and accessible book on modern biology.
    2. A fascinating topic in the hands of an author with great communication skills.
    3. What a wonderful way to learn about the history of biology.
    4. The origin of cells. Cell theory. "Our understanding of the origin of new cells can be largely attributed to Robert Remak--a lost hero of biology, and a victim of politics and race."
    5. The grand theory of evolution. An excellent explanation of what a theory constitutes in science.
    6. This book stands out in making complex biological topics accessible; a positive worth repeating. "There are no life-forms we know of that do not employ and entirely depend upon it: DNA, made of four letters, translates into proteins, made of twenty amino acids. It is known as the central dogma: DNA makes RNA makes protein. The fact that all known life is utterly dependent on this system makes it seem almost inconceivable that it is not related by a single, common origin."
    7. Fascinating facts abound, "For reasons we don't fully understand, proteins only use left-handed amino acids."
    8. A dose of cosmology. "Theia's glancing blow may be what shifted the earth's axis from vertical to its off-kilter stance of 23.5 degrees." How cool is that?
    9. Describing life. Great use of converging sciences like physics and chemistry to describe biology.
    10. The origin of the code, "Evolution has given us a comprehensive description of how the wild spectrum of species has arisen from this simple code, but very little about how it came to be."
    11. Understanding ribozymes.
    12. Interesting theories on origin-of-life. The author does a wonderful job of differentiating between degrees of probability.
    13. Many interesting science experiments including Nick Lane's bioreactor.
    14. Understanding of proteins.
    15. The future of biology, synthetic biology. Fascinating look! "What Craig Venter and his team did was to re-create a life-form synthetically. That is undoubtedly a huge achievement in itself. It's another incremental step on the pathway to having total control over DNA, and our ability to manipulate life."
    16. Some truly remarkable studies underway in synthetic biology.
    17. Electrical engineering and how it relates to synthetic biology.
    18. A discussion on the challenges of bringing synthetic biology into society.
    19. Touches upon issues like genetically modified food, and viruses.
    20. Annotated bibliography.

    Negatives:
    1. No explicit mention of epigenetics.
    2. Mentions that one magazine puts Venter as the fourteenth-most influential person on Earth, sandwiched between David Cameron and Sarah Palin. Really??
    3. No use of graphs or illustrations that could have added value.

    In summary, I really enjoyed this book. It's a fresh and interesting look at modern biology. Adam Rutherford has provided an enlightening gift for the public. It provides a fascinating look at the history of life and its future through synthetic biology. Don't miss this one, I highly recommend it!

    Further suggestions: "Wonders of Life: Exploring the Most Extraordinary Phenomenon in the Universe" by Brian Cox, "The Making of the Fittest: DNA and the Ultimate Forensic Record of Evolution" by Sean B. Carroll, "Before the Dawn: Recovering the Lost History of Our Ancestors" by Nicholas Wade, "The Universe Within: Discovering the Common History of Rocks, Planets, and People" by Neil Shubin, "Zoobiquity: The Astonishing Connection Between Human and Animal Health (Vintage)" by Barbara Natterson-Horowitz, "Life Ascending" by Nick Lane, "The Emperor of All Maladies: A Biography of Cancer" by Siddhartha Mukherjee, "The 10,000 Year Explosion" by Gregory Cochran, "Why Evolution Is True" by Jerry A. Coyne, "Relics of Eden: The Powerful Evidence of Evolution in Human DNA" by Daniel J. Fairbanks, "The Greatest Show on Earth: The Evidence for Evolution" by Richard Dawkins, "Written in Stone" by Brian Switek, "Molecular & Cell Biology for Dummies" by Rene Fester Kratz, "Evolution For Dummies" by Greg Krukonis, "Evolution: What the Fossils Say and Why it Matters" by Donald R. Prothero, "The Universe Inside You: The Extreme Science of the Human Body From Quantum Theory to the Mysteries of the Brain" by Brian Clegg, "The Violinist's Thumb: And Other Lost Tales of Love, War, and Genius, as Written by Our Genetic Code" by Sam Kean.
    Report
  • JS
    4.0 out of 5 stars An Overview
    Reviewed in Germany on 13 May 2014
    Verified Purchase
    Creation: The Origin of Life / The Future of Life gives a nice overview over biology's history and current trends. I sometimes missed a little deeper explanation.
    Report

Report an issue


Does this item contain inappropriate content?
Report
Do you believe that this item violates a copyright?
Report
Does this item contain quality or formatting issues?
Report